mp6 plasmid Search Results


mutagenesis plasmid mp6  (Addgene inc)
93
Addgene inc mutagenesis plasmid mp6
Inducible bacterial <t> mutagenesis </t> plasmids
Mutagenesis Plasmid Mp6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mp6+plasmid/MP6+(Plasmid+%2369669)/pmc07865204-426-0-3
Average 93 stars, based on 1 article reviews
mutagenesis plasmid mp6 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
mp6 plasmid  (Addgene inc)
92
Addgene inc mp6 plasmid
Fig. 3. Summarization of PD1 variants that bind PDL1. (A) Under high levels of mutagenesis <t>(MP6)</t> during the 288 h of PACE. The Red line indicates the phage titer of each time point. And the grey line indicates the flow velocity of system. (B) During 288 h of evolution, “lagoon” samples were sequenced using the Sanger method, and 11 different preponderant oligotypes were identified which contained 9 amino acid sites. (C) Among these 11 oligotypes, 9 amino acids exhibited diverse retention from 9 times of T98L to 3 times G18A. (D) The summarization of 11 oligotypes is shown on a time axis.
Mp6 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mp6+plasmid/MP6+(Plasmid+%2369403)/pm32860814-61-2-10
Average 92 stars, based on 1 article reviews
mp6 plasmid - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

Image Search Results


Inducible bacterial mutagenesis plasmids

Journal: Nature protocols

Article Title: Phage-assisted continuous and non-continuous evolution

doi: 10.1038/s41596-020-00410-3

Figure Lengend Snippet: Inducible bacterial mutagenesis plasmids

Article Snippet: Mutagenesis plasmid MP6 (Addgene 69669) Drift plasmid DP6 (Addgene deposition in progress) pJC175e (Addgene 79219) Selection phage 5 , derived from bacteriophage M13 ( {"type":"entrez-nucleotide","attrs":{"text":"V00604.2","term_id":"56713234"}} V00604.2 , ATCC 15669-B1) with the following modifications, see Supplementary Note 1 : Removal of gIII Substitution of gIII RBS with synthetic RBS 36 Insertion of gene of interest immediately following synthetic RBS Insertion of the following sequence, containing an artificial promoter and RBS for production of downstream gVI: tctagaaggagattttcaacatgggctagcacagccctaggtattatgctagcgtggtgtatttggaataaggagtcaaaa

Techniques: Mutagenesis

Fig. 3. Summarization of PD1 variants that bind PDL1. (A) Under high levels of mutagenesis (MP6) during the 288 h of PACE. The Red line indicates the phage titer of each time point. And the grey line indicates the flow velocity of system. (B) During 288 h of evolution, “lagoon” samples were sequenced using the Sanger method, and 11 different preponderant oligotypes were identified which contained 9 amino acid sites. (C) Among these 11 oligotypes, 9 amino acids exhibited diverse retention from 9 times of T98L to 3 times G18A. (D) The summarization of 11 oligotypes is shown on a time axis.

Journal: Experimental cell research

Article Title: Using phage-assisted continuous evolution (PACE) to evolve human PD1.

doi: 10.1016/j.yexcr.2020.112244

Figure Lengend Snippet: Fig. 3. Summarization of PD1 variants that bind PDL1. (A) Under high levels of mutagenesis (MP6) during the 288 h of PACE. The Red line indicates the phage titer of each time point. And the grey line indicates the flow velocity of system. (B) During 288 h of evolution, “lagoon” samples were sequenced using the Sanger method, and 11 different preponderant oligotypes were identified which contained 9 amino acid sites. (C) Among these 11 oligotypes, 9 amino acids exhibited diverse retention from 9 times of T98L to 3 times G18A. (D) The summarization of 11 oligotypes is shown on a time axis.

Article Snippet: SP098, pAB107a, MP6 plasmid, S2060 and S2208 were obtained from Addgene.

Techniques: Mutagenesis